View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_38 (Length: 353)
Name: NF14819_low_38
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 2954418 - 2954314
Alignment:
| Q |
15 |
catctctttatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcactagtgtggccttta |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
2954418 |
catctcttcatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcact--tgtgggcttta |
2954321 |
T |
|
| Q |
115 |
tccctcg |
121 |
Q |
| |
|
| ||||| |
|
|
| T |
2954320 |
tacctcg |
2954314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 316
Target Start/End: Original strand, 19407005 - 19407041
Alignment:
| Q |
280 |
tcttgcatgtgatcgacttgtcttattgcatgagatg |
316 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19407005 |
tcttgcatgtgatacacttgtcttattgcatgagatg |
19407041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University