View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_53 (Length: 309)
Name: NF14819_low_53
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 185 - 293
Target Start/End: Complemental strand, 41653311 - 41653203
Alignment:
| Q |
185 |
catttgcagattcctctgtatcaaattgaacaaagccatatcctttactcttcccatcctcagacattacaactttacttgacaaaatattcccaaactt |
284 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653311 |
catttgcagattcctctgtttcaaattgaacaaagccatatcctttactcttcccatcctcagacattacaactttacttgacaaaatattcccaaactt |
41653212 |
T |
 |
| Q |
285 |
cttaaacat |
293 |
Q |
| |
|
||||||||| |
|
|
| T |
41653211 |
cttaaacat |
41653203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 9200321 - 9200430
Alignment:
| Q |
1 |
catagaatgtatctttgctgttacctgtttataatttaaacatcaaattaaatgttcaaaataatatatagtagcatgaatttttataaatcaaaatcca |
100 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||| |||||||||||||| ||||||||||||| ||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
9200321 |
catagaaggtatctttgct-ttacatgtttatactttaaacatcaaatcaaatgttcaaaatgatatacagtagcatgagtttttataaaacaaaatcca |
9200419 |
T |
 |
| Q |
101 |
gatcttactta |
111 |
Q |
| |
|
|| ||||||| |
|
|
| T |
9200420 |
tatattactta |
9200430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University