View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_60 (Length: 291)
Name: NF14819_low_60
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 91 - 264
Target Start/End: Complemental strand, 41825710 - 41825536
Alignment:
| Q |
91 |
tctttgatcaaggggtttctaggaggatgaatgttgatttttaaagcttttgggattacaaattccctcatattgctggaagcaacaagtttaa-ttgtt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
41825710 |
tctttgatcaaggggtttctaggaggatgaatgttgatttttaaagcttttgggattacaaattccctcatattgctggaagcaataagtttaatttgtt |
41825611 |
T |
 |
| Q |
190 |
acctgataaagtgacttttgaaatgatcatactaatggttgtcttccatagaatttgttaatcctgaaacatgga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
41825610 |
acctgataaagtgacttttgaaatgatcatactaatggttgtcttccatagaatttgtttgtcctgaaacttgga |
41825536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 41826520 - 41826421
Alignment:
| Q |
1 |
tccaacatatgaagcattgggtggaattttttgtcactgcaccatatgtattgacatttatccaattgacaagagggggtccagagaaattctttgatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41826520 |
tccaacatatgaagcattgggtggaattttttgtcactgcaccatatgtattgacatttatccaattgacaagagggggtccagagaaattctttgatca |
41826421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University