View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_63 (Length: 285)
Name: NF14819_low_63
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 5 - 278
Target Start/End: Complemental strand, 9660220 - 9659951
Alignment:
| Q |
5 |
ctttctttccctatgataccttcctctagttagtccaagacatttacttttttcaaaaataatattcatatattaattagtacacttatatctatatgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
9660220 |
ctttctttccctatgataccttcctctagttagtccaagacatttacttttttcaaaaataatattcagata---attagtacacttatatctatatgtt |
9660124 |
T |
 |
| Q |
105 |
gatttatttgcattgannnnnnnnnnnattatgggggtacttgcaattcactaaactgaaaagtccaacatgaataataaaacaataaaaacctatcgat |
204 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9660123 |
gatttatttgcattgattttttatt--attatgggggtacttgtaattcactaaaatgaaaagtccaacatgaataataaaacaataaaaacctatcgat |
9660026 |
T |
 |
| Q |
205 |
tgcaaattagtaaaaccccct-taaaataaaatctataggggcagtttggaactaaaatgcatacattgtccttt |
278 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9660025 |
tgcaaattagtaaaaccccctaaaaaataaaatctataggggcattttggaactaaaatgcatacattgtccttt |
9659951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University