View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_low_67 (Length: 281)

Name: NF14819_low_67
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_low_67
NF14819_low_67
[»] chr2 (2 HSPs)
chr2 (21-132)||(18341810-18341921)
chr2 (246-276)||(22191043-22191073)
[»] chr6 (2 HSPs)
chr6 (143-249)||(16339495-16339600)
chr6 (21-70)||(16341355-16341404)
[»] chr7 (1 HSPs)
chr7 (247-276)||(21690414-21690443)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 21 - 132
Target Start/End: Complemental strand, 18341921 - 18341810
Alignment:
21 tttgagagagcaatgattaagttgaatatgatggatatagatagttaagtctatgtgatggatatagatagttatgtttgatctaagaactacacttcag 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
18341921 tttgagagagcaatgattaagttgaatatgatggatatagatagttaagtctatgtgatggatatagatagttatgtttgatctaagaactacacttgag 18341822  T
121 gatgctaaatat 132  Q
    ||||||||||||    
18341821 gatgctaaatat 18341810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 276
Target Start/End: Original strand, 22191043 - 22191073
Alignment:
246 ttaggctaaactacacttttcgtcccctatg 276  Q
    |||||||||||||||||||||||||||||||    
22191043 ttaggctaaactacacttttcgtcccctatg 22191073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 143 - 249
Target Start/End: Complemental strand, 16339600 - 16339495
Alignment:
143 gatatacatcaaaggatggtatatttgtatgactagttgtgtttgttatgtatatattgatgttttacaaacccatcccctttgtgaaacttgtacgtaa 242  Q
    ||||| ||||||||||||||   ||||||||| |||||||| |||| |||||||||||  |||||||||||| |||||||  ||| ||||||||| ||||    
16339600 gatatccatcaaaggatggtcg-tttgtatgattagttgtgattgtcatgtatatattattgttttacaaactcatccccactgttaaacttgtatgtaa 16339502  T
243 atcttag 249  Q
    | |||||    
16339501 accttag 16339495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 16341404 - 16341355
Alignment:
21 tttgagagagcaatgattaagttgaatatgatggatatagatagttaagt 70  Q
    |||||||||| ||| |||||||||||||||||||||||||||||||||||    
16341404 tttgagagagaaataattaagttgaatatgatggatatagatagttaagt 16341355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 276
Target Start/End: Original strand, 21690414 - 21690443
Alignment:
247 taggctaaactacacttttcgtcccctatg 276  Q
    ||||||||||||||||||||||||||||||    
21690414 taggctaaactacacttttcgtcccctatg 21690443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University