View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_69 (Length: 278)
Name: NF14819_low_69
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 155 - 269
Target Start/End: Original strand, 14597098 - 14597212
Alignment:
| Q |
155 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597098 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
14597197 |
T |
 |
| Q |
255 |
gacacaggttctgct |
269 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
14597198 |
gacacagattctgct |
14597212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 21 - 104
Target Start/End: Original strand, 14596964 - 14597047
Alignment:
| Q |
21 |
accctgtaaccacgtcttctgtcactgacccataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
104 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14596964 |
accctgtaaccacatcctctgtcactgacccataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
14597047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 23 - 104
Target Start/End: Complemental strand, 14611604 - 14611523
Alignment:
| Q |
23 |
cctgtaaccacgtcttctgtcactgacccataaatccatcccactctttctccccattctgtcttgtcttcatacctacatg |
104 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14611604 |
cctgtaacgacgtcctctgtcactgatccataaatccatcccactctgtctccccattctgtcttctcttcgtacctacatg |
14611523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 99
Target Start/End: Original strand, 15417195 - 15417259
Alignment:
| Q |
35 |
tcttctgtcactgacccataaatccatcccactctttctccccattctgtcttgtcttcatacct |
99 |
Q |
| |
|
|||||||||||||| ||||||||||| || | ||| |||||||||||||| || || |||||||| |
|
|
| T |
15417195 |
tcttctgtcactgatccataaatccaacctattctatctccccattctgttttatcctcatacct |
15417259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 47 - 98
Target Start/End: Original strand, 12192808 - 12192859
Alignment:
| Q |
47 |
gacccataaatccatcccactctttctccccattctgtcttgtcttcatacc |
98 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
12192808 |
gacccgtaaatccatccaactctatctccccattcggtcttatcttcatacc |
12192859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University