View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_70 (Length: 272)
Name: NF14819_low_70
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 55 - 259
Target Start/End: Complemental strand, 30349768 - 30349564
Alignment:
| Q |
55 |
caagtgccctcaaaattgtaaccccttgctaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata |
154 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349768 |
caagtgccctcaaaattgtaaccccttactaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata |
30349669 |
T |
|
| Q |
155 |
tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349668 |
tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg |
30349569 |
T |
|
| Q |
255 |
aaact |
259 |
Q |
| |
|
||||| |
|
|
| T |
30349568 |
aaact |
30349564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University