View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_76 (Length: 254)
Name: NF14819_low_76
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 2954423 - 2954665
Alignment:
| Q |
1 |
aatatgcttggaaaatcaaatttttgtgttacagaacccaacaaatattcaaaaggaaggtatacattaggaaactgaattctattgatagtcttataat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2954423 |
aatatgcttggaaaatcaaattttggtgttatagaacccaacaaatattcaaaaggaaggtatacattaggaaaatgaattctattgatagtcttataat |
2954522 |
T |
 |
| Q |
101 |
ctataagagaagcataatgtctaggctccaaggcattcaaagggctatccacaatggtagtggacacaaatcaagaggagcatatgttgttccacagatc |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2954523 |
ccataagagaagcataatgtctaggctccaaggcactcaaagggctatccacaatggtagtggacacaaatcaagaggagcatatgttgttccacagatc |
2954622 |
T |
 |
| Q |
201 |
aagggcaagctggttagttggtggggatagtaatactcgatat |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2954623 |
aagggcaaactggttagttggtggggatagtaatactcgatat |
2954665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University