View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_80 (Length: 252)
Name: NF14819_low_80
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 38532696 - 38532925
Alignment:
| Q |
16 |
cattgttcatagccacagcgatcacaaccttcggtacatcctcatcactacattgtccaatctcctcctcgatccgagcccgatcaaacgacgacaacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38532696 |
cattgttcatagccacagcgatcacaaccttcggtacatcctcatcactacattgtccaatctcctcctcgatccgagcccgatcaaacgaggacaacaa |
38532795 |
T |
 |
| Q |
116 |
tccctcaccgatccaactaagagccattcttcactacgccacatcacgtgttgttcctcaacaatcggtctcagagatcaagatcagtttcgatgtctta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532796 |
tccctcaccgatccaactaagagccattcttcactacgccacatcacgtgttgttcctcaacaatcggtctcagagatcaagatcagtttcgatgtctta |
38532895 |
T |
 |
| Q |
216 |
aaaacctacgatcgaccatgcaactttctt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38532896 |
aaaacctacgatcgaccatgcaactttctt |
38532925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University