View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_88 (Length: 240)
Name: NF14819_low_88
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_88 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 35865771 - 35865544
Alignment:
| Q |
1 |
gttatattataatcggtctattacttttagttaaaacatttctatttgatcatcatcaatcattgtcatgttgactattctgaatttggtactatcttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35865771 |
gttatattataatcggtctattacttttagttaaaacatttctatttgatcatcatcaatcattgtcatgttgactattctgaatttggtgttatcttgc |
35865672 |
T |
|
| Q |
101 |
attggtgcagagagagtttgtggcnnnnnnnncttcataatctttcaactgtagggacatgaaaatatcgtggttcttgttgacaaggacgattgtgact |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35865671 |
attggtgcagagagagtttgtggc-tttttttcttcataatctttcaactgtagggacatgaaaatatcgtggttcttgttgacaaggacgattgtgact |
35865573 |
T |
|
| Q |
201 |
aatgttgcttcatttatccttgatgatgt |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
35865572 |
aatgttgcttcatttatccttgattatgt |
35865544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University