View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14819_low_99 (Length: 223)
Name: NF14819_low_99
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14819_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 17517823 - 17517605
Alignment:
| Q |
1 |
tatacacctgcagtgttttaagattacaaatgcattacaacattgatctttgtagttttggtttttcaatgaataaactctaacaagtaacaactagact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17517823 |
tatacacctgcagtgttttaagattacaaatgcattacaacattgatttttttagttttggtttttcaatgaataaactctaacaagtaacaactagact |
17517724 |
T |
|
| Q |
101 |
atatacatcaaatctgattaagcacaatatgtgtagcaatacagcattggctaaatgtacacttcgcaaccgcgatctaggcaaccagaattttttatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17517723 |
atatacatcaaatctgattaagcacaatttgagtagcaatacagcattggctaaatatacacttcgcaaccgcgatctaggcaaccagaattttttatgt |
17517624 |
T |
|
| Q |
201 |
gtacgactgcaatgtgacc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
17517623 |
gtacgactgcaatgtgacc |
17517605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University