View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1481_high_10 (Length: 228)
Name: NF1481_high_10
Description: NF1481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1481_high_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 33885994 - 33886206
Alignment:
| Q |
16 |
tgttcttcctcattttggactcaaacagcgtttccatgtttctctgaaaatgtaaatcataattacagattgattgcaatagacctgttgggatttggaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885994 |
tgttcttcctcattttggactcaaacagtgtttccatgtttctctgaaaatgtaaatcataattacagattgattgcaatagacctgttgggatttggaa |
33886093 |
T |
 |
| Q |
116 |
agagtccaaagccaagagattgtttgtacaaattgaaggatcatgtggaaatgattgagaaatctgtggttcaaccattgcagttaggtagttttaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33886094 |
agagtccaaagccaagagattgtttgtacacattgaaggatcatgtggaaatgattgagaaatctgtggttcaaccattgcagttaggtagttttcatct |
33886193 |
T |
 |
| Q |
216 |
ggttgcacactct |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33886194 |
ggttgcacactct |
33886206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University