View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1481_high_5 (Length: 300)
Name: NF1481_high_5
Description: NF1481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1481_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 38749058 - 38749278
Alignment:
| Q |
1 |
tgcatttcttttgctttgtctttgcgttttttatccgtttctcttcagtgacttagtatagtt--ttaccctacaaattctcattcataactccataatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38749058 |
tgcatttcttttgctttgtcttttcgttttttatccgtttctcttccttgacttagtatagttagttaccctacaaattctcattcataactccataatt |
38749157 |
T |
 |
| Q |
99 |
tgctggataagcatgcgataaaattgttggggcatgactcatgatcaggtctaagatatgg----tatattgag-taaaaacaattacataaatgagttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
38749158 |
tgctggataagcatgcgataaaattgttggggcatgactcatgatcaggtctaagatatggcatatatattgagctaaaaacaattgcataaataagttg |
38749257 |
T |
 |
| Q |
194 |
caaatcaaatcttatcttaac |
214 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38749258 |
caaatcaaatcttatcttaac |
38749278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University