View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14820_high_17 (Length: 236)
Name: NF14820_high_17
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14820_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 92 - 219
Target Start/End: Complemental strand, 53700687 - 53700560
Alignment:
| Q |
92 |
gtcgaaatgacaaataaacaccacacacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700687 |
gtcgaaatgacaaataaacaccacacacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtg |
53700588 |
T |
 |
| Q |
192 |
gaaaaaattataatctagtacaagatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53700587 |
gaaaaaattataatctagtacaagatat |
53700560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 53700796 - 53700755
Alignment:
| Q |
1 |
gtaaatttgatgaggtggaatggaaggtttgctagttctcaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700796 |
gtaaatttgatgaggtggaatggaaggtttgctagttctcaa |
53700755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University