View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14820_high_17 (Length: 236)

Name: NF14820_high_17
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14820_high_17
NF14820_high_17
[»] chr4 (2 HSPs)
chr4 (92-219)||(53700560-53700687)
chr4 (1-42)||(53700755-53700796)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 92 - 219
Target Start/End: Complemental strand, 53700687 - 53700560
Alignment:
92 gtcgaaatgacaaataaacaccacacacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtg 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53700687 gtcgaaatgacaaataaacaccacacacaagaaccagataagatttatttatcagtgggaattttaagtaacatgagggttaattttggaaatatttgtg 53700588  T
192 gaaaaaattataatctagtacaagatat 219  Q
    ||||||||||||||||||||||||||||    
53700587 gaaaaaattataatctagtacaagatat 53700560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 53700796 - 53700755
Alignment:
1 gtaaatttgatgaggtggaatggaaggtttgctagttctcaa 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
53700796 gtaaatttgatgaggtggaatggaaggtttgctagttctcaa 53700755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University