View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14820_low_12 (Length: 307)
Name: NF14820_low_12
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14820_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 12813762 - 12814054
Alignment:
| Q |
1 |
tattaaccctctcactccttcttctaagaaaattttgacaaaggtcatatatagtgcatggttagaacgtgttgaaaaacaaaacgccctctttatagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12813762 |
tattaaccctctcactccttcttctaagaaaattttgacaaaggtcatatatagtgcatggttagaacgtgttgaaaaacaaaacgccccctttatagaa |
12813861 |
T |
 |
| Q |
101 |
actgataggtacttataatctaatcatgctctgcaaatctaatatgtattacaacattcctcaaattttcagttctctttattttattttacgaatcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12813862 |
actgataggtacttataatctaatcatgctctgcaaatctattatgtattacaacattcctcaaattttcagttctctttattttattttacgaatcctt |
12813961 |
T |
 |
| Q |
201 |
tgaattgcacttttcatactccttatatggcatacttgtcgtcaatgatttgatattgctgctcacatgactcaaacttacgggtagtctctg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12813962 |
tgaattgcacttttcatactccttatatggcatacttaccgtcaattatttgatattgctgctcacatgactcaaacttacgggtagtctctg |
12814054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University