View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14820_low_23 (Length: 204)
Name: NF14820_low_23
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14820_low_23 |
 |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0317 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0515 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 33 - 154
Target Start/End: Complemental strand, 375 - 254
Alignment:
| Q |
33 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatactgaatc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
375 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatattgaatc |
276 |
T |
 |
| Q |
133 |
taaagtaactgaaaatttcaaa |
154 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
275 |
taaagtaactgaaaatttcaaa |
254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 33 - 154
Target Start/End: Original strand, 18832 - 18953
Alignment:
| Q |
33 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatactgaatc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18832 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatattgaatc |
18931 |
T |
 |
| Q |
133 |
taaagtaactgaaaatttcaaa |
154 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18932 |
taaagtaactgaaaatttcaaa |
18953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 33 - 154
Target Start/End: Complemental strand, 377 - 256
Alignment:
| Q |
33 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatactgaatc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
377 |
attatactcaaagtcataaaatatatatgaatagttctctatatcacaaatttaaatacattacgattgatcaagacaattgtatgaagaatattgaatc |
278 |
T |
 |
| Q |
133 |
taaagtaactgaaaatttcaaa |
154 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
277 |
taaagtaactgaaaatttcaaa |
256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University