View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14820_low_7 (Length: 369)
Name: NF14820_low_7
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14820_low_7 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 202 - 369
Target Start/End: Original strand, 53700930 - 53701097
Alignment:
| Q |
202 |
ccaattacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttctgatcttaagatgtgtctgttgttggtgtttccacactttctgt |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700930 |
ccaatcacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttcttatcttaagatgtgtctgttgttggtgtttccacactttctgt |
53701029 |
T |
 |
| Q |
302 |
tcttcttacatgattttcaccaccaccgcttccttgtttcacggttgattcttcatcattcatatttt |
369 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701030 |
tcttcttacatgattttcaccaccaccccctccttgtttcacggttgattcttcatcattcatatttt |
53701097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 21 - 137
Target Start/End: Original strand, 53700759 - 53700875
Alignment:
| Q |
21 |
gaactagcaaaccctccattccacctcatcaaatttacattcccgaaatatcaatgtacagttgtactttgtagatattgaagaaaattacacatgtccc |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700759 |
gaactagcaaaccttccattccacctcatcaaatttacattcccgaaatatcaatgtacagttgtactttgtagatattgaagaaaattacacatgtccc |
53700858 |
T |
 |
| Q |
121 |
ataaaaagaagagaagg |
137 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53700859 |
ataaaaagaagagaagg |
53700875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University