View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14820_low_9 (Length: 362)
Name: NF14820_low_9
Description: NF14820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14820_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 48345388 - 48345635
Alignment:
| Q |
1 |
tggacaagagtaagaaagaggaggaagttgctagagaatttttaacagagtaccatcttaaccataagattttgagggatttttctatgaagaaaaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48345388 |
tggacaagagtaagaaagaggaggaagttgctagagaatttttaagagagtaccatcttaaccataagattttgagggatttttctatgaagaaaaatga |
48345487 |
T |
 |
| Q |
101 |
agaagtnnnnnnnnnnnnnnnnntatcaagttgttcaagttcagatctttttgagcttgatcacttggatgtgatgggaaatgataggtattgtgaagat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48345488 |
agaagttgatgatgatg------tatcaagttgttcaagttcagatctttttgagcttgatcacttggatgtgatgggaaatgataggtattgtgaagat |
48345581 |
T |
 |
| Q |
201 |
ttacctgtgtttgaaactactcatgttagtactaatcgtgctattcgtataatg |
254 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48345582 |
ttacctgtgtttgagactactcatgttagtactaatcgtgctattcgcataatg |
48345635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 280 - 345
Target Start/End: Original strand, 48345654 - 48345719
Alignment:
| Q |
280 |
gtagaaccatatgataattaactatacaggttatataatcattttattaatttcttcactgttgtt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48345654 |
gtagaaccatatgataattaactatacaggttatataatcattttattaatttcttcactgttgtt |
48345719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University