View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_high_13 (Length: 267)
Name: NF14821_high_13
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 4080823 - 4081035
Alignment:
| Q |
1 |
tgactcttttgtatccctttgttagtttatagtttt-tatgcaatacttagatgtacatgtggtatgccttttaattatctaggtgagaagcattccttg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4080823 |
tgactcttttgtatccctttgttagtttatagttttttatgcaatacttagatgtacatgtggtatgccttttaattatctaggtgagaagcattccttg |
4080922 |
T |
 |
| Q |
100 |
gcctgatatgagtttattaatatgtttttgttgttcttagggaagccaatcttctgcatgtccttataatttgttttttacttttatatattcgagattg |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4080923 |
gcctgatatgagtttattaatatgcttttgttgtccttagggaagccaatcttctgcatgtccttataatttgttttttgcttttatatattcgagattg |
4081022 |
T |
 |
| Q |
200 |
gatatggacaatg |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4081023 |
gatatggacaatg |
4081035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 4845735 - 4845684
Alignment:
| Q |
8 |
tttgtatcccttt-gttagtttatagtttttatgcaatacttagatgtacat |
58 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4845735 |
tttgtatcccttttgttagtttatagtttttatgcaatatttagatgtacat |
4845684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University