View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_high_16 (Length: 238)
Name: NF14821_high_16
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 3146286 - 3146208
Alignment:
| Q |
156 |
aagggtacccttagtttcttagtctattcaactacttggtcattgcttttcactgtctttgtctttttcattttgttgg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
3146286 |
aagggtacccttagtttcttagtctattcaactacttggtcattgcttttcactgtctttgtctttttcacttttttgg |
3146208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 3146434 - 3146395
Alignment:
| Q |
18 |
cttgattcgtgtcaatcgttgagattaagatcctatcagc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3146434 |
cttgattcgtgtcaatcgttgagattaagatcctatcagc |
3146395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University