View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_high_7 (Length: 425)
Name: NF14821_high_7
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 113 - 311
Target Start/End: Complemental strand, 310709 - 310511
Alignment:
| Q |
113 |
atttagaaccattgcaagggagatgaagaattggtggtggttgtgacaacagcaacatttatccttaactttttatgtaacaaaacaacactaattcctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
310709 |
atttagaaccattgcaagggagatgaagaactggtggtggttgtgacaacagcaacatttatccttaactttttatgtaacaaaacaacactaattcctt |
310610 |
T |
 |
| Q |
213 |
tcctcaactttgcacaacactttcatggaacatagaataaaattatgggtctctgttttggttttagactaaacactaaactcagatatagtactgtcc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
310609 |
tcctcaactttgcacaacactttcatggaacatagaataaaattatgggtctctgttttggttttagactaaacacaaaactcagatatagtactgtcc |
310511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 310798 - 310746
Alignment:
| Q |
17 |
aatatccccaaaattaaaaactaaatgtaatagcccaagtattgagccttaag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
310798 |
aatatccccaaaattaaaaactaaatgtaatagcccaagtattgagccttaag |
310746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University