View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_low_14 (Length: 278)
Name: NF14821_low_14
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 17658613 - 17658838
Alignment:
| Q |
1 |
tgtttgcttgctctatgcgtcttgtgcagatgtagcggttaataaattttggttgtttnnnnnnnng--ctataacaggaaattgaattgatcttattgg |
98 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||| |
|
|
| T |
17658613 |
tgtttgcttgctctgtgcgtcttgtgcagatgtagcggttaataaattttggttgtttcaaaaaaaaaactataacaggaaattggattgatcttgttgg |
17658712 |
T |
|
| Q |
99 |
aattttaggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaaaaggttggagatcggaattatgtacaccgga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17658713 |
aattttaggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaaaaggttggagatcggaattatgtacaccgga |
17658812 |
T |
|
| Q |
199 |
tccaatagccttcacaggttctgctc |
224 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
17658813 |
tccaatagccttcacaggttgtgctc |
17658838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 260
Target Start/End: Original strand, 9629429 - 9629463
Alignment:
| Q |
226 |
ttcactgattcttgatcttgtctctagatggtaat |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
9629429 |
ttcattgattcttgatcttgtctctagatggtaat |
9629463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University