View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14821_low_18 (Length: 238)

Name: NF14821_low_18
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14821_low_18
NF14821_low_18
[»] chr2 (2 HSPs)
chr2 (156-234)||(3146208-3146286)
chr2 (18-57)||(3146395-3146434)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 3146286 - 3146208
Alignment:
156 aagggtacccttagtttcttagtctattcaactacttggtcattgcttttcactgtctttgtctttttcattttgttgg 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
3146286 aagggtacccttagtttcttagtctattcaactacttggtcattgcttttcactgtctttgtctttttcacttttttgg 3146208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 3146434 - 3146395
Alignment:
18 cttgattcgtgtcaatcgttgagattaagatcctatcagc 57  Q
    ||||||||||||||||||||||||||||||||||||||||    
3146434 cttgattcgtgtcaatcgttgagattaagatcctatcagc 3146395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University