View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_low_20 (Length: 234)
Name: NF14821_low_20
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 29 - 219
Target Start/End: Original strand, 9474307 - 9474497
Alignment:
| Q |
29 |
aagttttctagtcaaaagcaagagacatatcatgacgaagtatcatatcatatagtgaacaaatagttggtaaagggaagagaaaaatctatttctatgt |
128 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9474307 |
aagttttctagtcaaaagcaagtgacatatcatgacgaagtatcatatcatatagtgaacaaatagttggtaaagggaagagaaaaatctatttctatgt |
9474406 |
T |
 |
| Q |
129 |
tgtattttcatactatttcttttccttttttaatattgaggcttgtagtggttctgttccaaccaagtagaaaactacttattctgtaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9474407 |
tgtattttcatactatttcttttccttttttaatattgaggcttgtagtggttctgttccaaccaagtagaaaactacttattgtgtaatt |
9474497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University