View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14821_low_23 (Length: 218)
Name: NF14821_low_23
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14821_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 53842762 - 53842696
Alignment:
| Q |
18 |
atcaatgtatccatttactaaacggttttctgatattaattggcgtatccttgtgttgataattcct |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842762 |
atcaatgtatccatttactaaacggttttctgatattaattggcgtatccttgtgttgataattcct |
53842696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 53842630 - 53842579
Alignment:
| Q |
150 |
ttctgttcataatcttctttccaaccttccttttatcaacactgctaattct |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842630 |
ttctgttcagaatcttctttccaaccttccttttatcaacactgctaattct |
53842579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University