View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14822_low_10 (Length: 326)
Name: NF14822_low_10
Description: NF14822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14822_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 163 - 325
Target Start/End: Complemental strand, 45986440 - 45986275
Alignment:
| Q |
163 |
gacctttttgacacgagttcagctatcttaatcacagaaagtcaagaatgatgtgctacttttggggtccactctttcnnnnnnnaactctatcatc--- |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45986440 |
gacctttttgacacgagttcagctatcttaatcacagaaagtcaagaatgatgtgctacttttggggtccactctttc-ttttttaactctatcatcaca |
45986342 |
T |
|
| Q |
260 |
acaagattgttttagg-aaaaatctgtcaccacaagagtgtctctttcttgggtcaaacttttttct |
325 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45986341 |
acaaaattgttttaggaaaaaatctgtcaccacaagagtgtctctttcttgggtcaaacttttttct |
45986275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 45986587 - 45986515
Alignment:
| Q |
24 |
cagatgaattccataaaaatagatattactgttaggtatgtgcatactgcatagattaacagaaaagaatagc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45986587 |
cagatgaattccataaaaatagatattattgttaggtatgtgcatactgcatagattaacagaaaagaatagc |
45986515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University