View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14822_low_2 (Length: 454)
Name: NF14822_low_2
Description: NF14822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14822_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 6997064 - 6997236
Alignment:
| Q |
1 |
agtaagacaattgttgtgaacctcaattaggacatagtatatctccactacttactaggaacttgttcgagcctccatgcttttaggaaaatagtttgtg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6997064 |
agtaagacaattgttgtgaccctcaattaggacatagtatatctccactacttactaggaacttgttcgagcctccatgcttttaggaaaatagtttgtg |
6997163 |
T |
|
| Q |
101 |
tttcaatttctccctaatcaaaaactgtgggcgctagccgtcggtatatacttcaaccaatatgattctagaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6997164 |
tttcaatttctccctaatcaaaaactgtgggcgctagctgtcggtatatacttcaaccaatatgattctagaa |
6997236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 352 - 440
Target Start/End: Original strand, 6997282 - 6997370
Alignment:
| Q |
352 |
aaaatgatggttacccgcaattgatgggtgcccaaacttctttgttatgcgaagccagatagaattagatttggcaagttcaagtttct |
440 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6997282 |
aaaatgatggttacctgcgattgatgggtgcccaaacttctttgttatgcgaagtcagatagaattagatttggcaagtctaagtttct |
6997370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University