View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14822_low_9 (Length: 345)
Name: NF14822_low_9
Description: NF14822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14822_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 96 - 336
Target Start/End: Original strand, 39167822 - 39168062
Alignment:
| Q |
96 |
tatgaatggagactaacctcaggagctacttcttcgaccttctcagtcttgttaacggcacaaagcacttcaaagagcaccccagcagtctggtaagctt |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167822 |
tatgactggagactaacctcaggagctacttcttcgaccttctcagtcttgttaacggcacaaagcacttcaaagagcaccccagcagtctggtaagctt |
39167921 |
T |
|
| Q |
196 |
tactgagctgggtcctgtaaaaagatttcaatgtacagaatctgctacaacacatgggaaattagagaaacatagtaattagtatttacctgtctgcctg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167922 |
tactgagctgggtcctgtaaaaagatttcaatgtacagaatctgctacaacacatgggaaattagagaaacatagtaattagtatttacctgtctgcctg |
39168021 |
T |
|
| Q |
296 |
atccgcttggtcaagagctctgacatattgttcataatatt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39168022 |
atccgcttggtcaagagctctgacatattgttcataatatt |
39168062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 106 - 198
Target Start/End: Original strand, 43965335 - 43965427
Alignment:
| Q |
106 |
gactaacctcaggagctacttcttcgaccttctcagtcttgttaacggcacaaagcacttcaaagagcaccccagcagtctggtaagctttac |
198 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| || || |||||||||||||||| |
|
|
| T |
43965335 |
gactaacctcaggagcaacttcttcgactttctcagtcttgttaacagcacaaagcacttcaaaaagcacaccggcggtctggtaagctttac |
43965427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University