View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14823_high_7 (Length: 233)
Name: NF14823_high_7
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14823_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 15 - 160
Target Start/End: Original strand, 4678519 - 4678664
Alignment:
| Q |
15 |
caaaggttaacagtttatgaaggaatggctgtagagtcaagtcagggttacgtacttcttattttgggtcgtgaggttaagttattttttgacccttttc |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||| |||||||| |
|
|
| T |
4678519 |
caaaggttaacagtttatggaggaatggctgtagagtcaagtcagggttacgtacttcttattttcggtcgcgaggttaagtaattttttggcccttttc |
4678618 |
T |
|
| Q |
115 |
aaaaataagtaatcttttgggttatccacttgttaacatctatctc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4678619 |
aaaaataagtaatcttttgggttatccacttgttaacatctatctc |
4678664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University