View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14823_low_14 (Length: 215)
Name: NF14823_low_14
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14823_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 45 - 170
Target Start/End: Complemental strand, 5113366 - 5113241
Alignment:
| Q |
45 |
aatggaaaactatgcattgcacaaaaaggaagaaagataatatttattcttgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa |
144 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5113366 |
aatggaaaactatgcattgcacgaaaaggaagaaagataatatttattcatgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa |
5113267 |
T |
 |
| Q |
145 |
ctctgcatcaagctctttaattcttt |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5113266 |
ctctgcatcaagctctttaattcttt |
5113241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University