View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14823_low_15 (Length: 214)
Name: NF14823_low_15
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14823_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 20 - 197
Target Start/End: Complemental strand, 52133242 - 52133065
Alignment:
| Q |
20 |
agtagcgatgaagttgatgagataatgggattatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52133242 |
agtagcgatgaagttgatgagataatgggattatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtg |
52133143 |
T |
 |
| Q |
120 |
agcatacttgcaaacttcttgctgcccatcatgccaactctttcgacgtaatccgtgagagttcaaagggaaggaaga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52133142 |
agcatacttgcaaacttcttgctgcccatcatgccaactctttcgacgtaatccgtgagagttcaaagggaaggaaga |
52133065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 51 - 186
Target Start/End: Original strand, 17953320 - 17953455
Alignment:
| Q |
51 |
tatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtgagcatacttgcaaacttcttgctgcccatca |
150 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||| ||||| ||||||||| | ||| |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
17953320 |
tatcgttaactcttgatgagtggatgaagctggattctggtgacattgatgatgtcgataatatcagtgagcatacttcgaaacttcttgcagcccatca |
17953419 |
T |
 |
| Q |
151 |
tgccaactctttcgacgtaatccgtgagagttcaaa |
186 |
Q |
| |
|
||| |||||||||||| | ||||||| ||||||||| |
|
|
| T |
17953420 |
tgctaactctttcgactttatccgtgggagttcaaa |
17953455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University