View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14823_low_4 (Length: 415)
Name: NF14823_low_4
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14823_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 17 - 399
Target Start/End: Complemental strand, 11781831 - 11781449
Alignment:
| Q |
17 |
tcagccgaatctttagtccaaataacaccatcagagcatgtggcttctcctaaaatggcatcaatccccgctgaaggatctctagtacccgtgccttctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11781831 |
tcagccgaatctttagtccaaataacaccatcagagtatgtggcttctcctaaaatggcatcaatccccgctgaaggatctctagtacctgtgccttctc |
11781732 |
T |
 |
| Q |
117 |
tggtattcacaccagcagcagctgaattaagttttgaaccgtcaattcagatcgattcacagacagaagtagcagaaggcaaagaacatcatgaggttca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11781731 |
tggtattcacaccagcagcagctgaattaagttttgaaccgtcaattcagatcgattcacagacagaagtagcagaaggcaaagaacatcatgaggttca |
11781632 |
T |
 |
| Q |
217 |
gcattatggcgtggaaacaaatgatcagccacactcaatttcgatggagtttcatgcccctgaaggttctgattctggtgcaatagtaatagcaccatca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
11781631 |
gcattatggcgtggaaacaaatgatcagccacactcaatttcgatggagtttcatgcccctgcaggttctgattctggtgcaatagtaatagcaccacca |
11781532 |
T |
 |
| Q |
317 |
caagctcccattgcttctcaggtatccgcaccaatagcaacatttaaatcaagttttgaatctgaaaatcatcaagttataca |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11781531 |
caagctcccattgcttctcaggtatccgcaccaatagcaacatttaaatcaagttttgaatctgaaaatcatcaagttataca |
11781449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University