View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14824_high_2 (Length: 312)
Name: NF14824_high_2
Description: NF14824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14824_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 174 - 300
Target Start/End: Original strand, 43417088 - 43417214
Alignment:
| Q |
174 |
gtatggggtctcagtgtcaatgtcatatgtttttacattaaaatgtcgatgtatatgtgtcagtatcatgctagtatccatgttagaacttagagtgcat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43417088 |
gtatggggtctcagtgtcaatgtcatatgtttttacattaaaatgtcgatgtatatgtgtcagtatcatgctagtatccatgttagaacttagagtgcat |
43417187 |
T |
 |
| Q |
274 |
gggtccatatctcccacaccaaatcct |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43417188 |
gggtccatatctcccacaccaaatcct |
43417214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 43416917 - 43417025
Alignment:
| Q |
1 |
aagatgaaagactatcatatcttgttttagaannnnnnnnggtaatgaaacaaattgatcaatttagaggcatacatacatacatacatagagagagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
43416917 |
aagatgaaagactatcatatcttgttttagaattttttttggtaatgaaacaaattgatcaatttagaggcatgcatacatacatacat--agagagaca |
43417014 |
T |
 |
| Q |
101 |
cactgattctc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
43417015 |
cactgattctc |
43417025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University