View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14824_high_3 (Length: 223)
Name: NF14824_high_3
Description: NF14824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14824_high_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 36738103 - 36738320
Alignment:
| Q |
7 |
ggagtatctagtgggttcatgtaaataactaaattagtgttagcccaacaaaa-tgtgagagctcaaacattaggttacgatgccataaaatgattaaga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36738103 |
ggagtatctagtgggttcatgtaaataaccaaattagtgttagcctaacaaaaatgtgagagctcaaacattaggatacgatgccataaaatgattaaga |
36738202 |
T |
 |
| Q |
106 |
acatagagagaaacatatattttgtactaaatagactagagagtgacctaaacttgtgtttaaaaggagaacccatctttaccttaaaatacaaacaaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36738203 |
acatagagagaaacatatattttgtactaaatagactagagagtgacctaaacttgtgtttaaaaggagaacccatctttaccttaaaatacaaacaaaa |
36738302 |
T |
 |
| Q |
206 |
atattggggagttatttc |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36738303 |
atattggggagttatttc |
36738320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University