View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14824_low_5 (Length: 209)
Name: NF14824_low_5
Description: NF14824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14824_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 16 - 138
Target Start/End: Original strand, 38238637 - 38238761
Alignment:
| Q |
16 |
atatgcagattaaattgtcggcccgattcagccatgaaagatat--gatgtgtgccttacatggctgtgtcgaattgagttctttgtaccatggttgaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38238637 |
atatgcagattaaattgtcggcccgattcagccatgaaagatatatgatgtgtgccttacatggctgtgtcgaattgagttctttgtaccatggttgaag |
38238736 |
T |
|
| Q |
114 |
tgactcaaccaagttattgtatcat |
138 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
38238737 |
tgactcaaacaagttattgtatcat |
38238761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 106
Target Start/End: Original strand, 37070661 - 37070702
Alignment:
| Q |
65 |
gtgccttacatggctgtgtcgaattgagttctttgtaccatg |
106 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
37070661 |
gtgccttacacggctgtctcgaattgagttctttgtaccatg |
37070702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University