View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14825_high_12 (Length: 242)
Name: NF14825_high_12
Description: NF14825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14825_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 36562629 - 36562448
Alignment:
| Q |
18 |
atgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaaccattgaggttgctctggagaaggaaagggaaatgatggtggaaaatagtaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36562629 |
atgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaactattgaggttgctctggagaaggaaagggaaatgatggtggaaaatagtaaatt |
36562530 |
T |
|
| Q |
118 |
ggttggagagaagaaggagatggagaagagtattgagaatttgactgaggggagggatactgcttataggaccctggatatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36562529 |
ggttggagagaagaaggagatggagaagagtattgagaatttgactgaggggagggatactgtttataggaccctggatatg |
36562448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University