View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14825_low_5 (Length: 397)
Name: NF14825_low_5
Description: NF14825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14825_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 155 - 275
Target Start/End: Original strand, 38184674 - 38184794
Alignment:
| Q |
155 |
agaaagagttggaagttggaacataaagatctcattttcatgatcatggataattgaattcaatatccatgtgttagtacaaattaaaaagcagcaagta |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184674 |
agaaagagttggaagttggaacataaagatctcattttcatgatcatggataattgaattcaatatccatgtgttagtacaaattaaaaagcagcaagta |
38184773 |
T |
|
| Q |
255 |
gctagtagctactacacttat |
275 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
38184774 |
gctagtagctaccacacttat |
38184794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 38184520 - 38184629
Alignment:
| Q |
19 |
agaaattgcacaagataaatatatgttatttgaattgactcaccaaaactaagcacataggacctaaaattgtagataaggagctccaacttccaacttg |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| | |||||||| || ||| |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38184520 |
agaaattgcacaagataaatata-gttatttgaattgatttaccaaaaccaaatacacaggacctaaaattgtagaaaaggagttccaacttccaacttg |
38184618 |
T |
|
| Q |
119 |
agaaaagtgag |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
38184619 |
agaaaagtgag |
38184629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 337 - 380
Target Start/End: Original strand, 38184853 - 38184896
Alignment:
| Q |
337 |
gtatcttagtcatggtaagaacgaagagtagctccacaaaaggt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184853 |
gtatcttagtcatggtaagaacgaagagtagctccacaaaaggt |
38184896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University