View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14827_high_12 (Length: 272)
Name: NF14827_high_12
Description: NF14827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14827_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 4 - 257
Target Start/End: Complemental strand, 25606020 - 25605769
Alignment:
| Q |
4 |
gtatcattatgagagatgacttgggaaacttaattgcaaaggcatccaagttgatgcgacttcagatgaagccatgggattttgggaaactatagagttc |
103 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25606020 |
gtatcattatcaaagatgacttgggaaacttaattgcaaaggcatccaagttgatgcgacttcagatgaagccatgggattttgggaaactatagagttc |
25605921 |
T |
 |
| Q |
104 |
acgtaataattagatcaaaattttcataaccctttgtttagaattcggttttggctatctcttgttacaagtttttcttgtcgttattggggaagcatcg |
203 |
Q |
| |
|
|| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25605920 |
acataataattagatcaaaaatttcataacactttgtttagaattcggttttggcta--tcttgttacaagtttttcttgtcgttattggggaagcatcg |
25605823 |
T |
 |
| Q |
204 |
ctaggagggtaattgaatggcccattatttgacaaattggactaataaaaatct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25605822 |
ctaggagggtaattgaatggcccattatttgacaaattggactaataaaaatct |
25605769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University