View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14827_high_18 (Length: 230)
Name: NF14827_high_18
Description: NF14827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14827_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 32002773 - 32002557
Alignment:
| Q |
11 |
taaagtatgattaatactaattgtaccattaaagcaagaaaataatgtaggcaatgaagaaaaagaaaggctaaagcactttcattggtcccatacattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32002773 |
taaagtatgattaatactaattgtaccattaaagcaagaaaataatgtaggcaatgaagaaaaagaaaggctaaagcactttcattggtcccatacattg |
32002674 |
T |
|
| Q |
111 |
tcccctcattagccctttgatgtgataccctaaattannnnnnnnnnnnnnnnnnnnaaatatatttcttccacttctattctattgtcttctctcttct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32002673 |
tcccctcattagccctttgatgtgataccctaaattatttttttcatttttagttttaaatatatttcttccacttctattctattgtcttctctcttct |
32002574 |
T |
|
| Q |
211 |
ctcccttcatctcactc |
227 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
32002573 |
ctcccttcttctcactc |
32002557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University