View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14827_high_20 (Length: 217)
Name: NF14827_high_20
Description: NF14827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14827_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 6414925 - 6415109
Alignment:
| Q |
15 |
atgaaaggatacaacttgttcttgttaatgtttttgacaactcatggtgattcttggatgatactactaagaaatttcacaaagttatcaaagcaacctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414925 |
atgaaaggatacaacttgttcttgttaatgtttttgacaactcatggtgattcttggatgatactactaagaaatttcacaaagttatcaaagcaacctc |
6415024 |
T |
 |
| Q |
115 |
actcagggatcaaaattaattaatgtacaaacagtatagtcagcttgaatgtagtaataatttatgtacgtgacaatagtttaaa |
199 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6415025 |
actcaaggaccaaaattaattaatgtacaaacagtatagtcagcttgaatgtagtaataatttatgtacgtgacaatagtttaaa |
6415109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 23287969 - 23287917
Alignment:
| Q |
15 |
atgaaaggatacaacttgttcttgttaatgtttttgacaactcatggtgattc |
67 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23287969 |
atgaaaggatacaatttgttcttgttaatgtttttgacaactcatggtgattc |
23287917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University