View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14827_low_10 (Length: 323)
Name: NF14827_low_10
Description: NF14827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14827_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 16 - 137
Target Start/End: Original strand, 39725649 - 39725770
Alignment:
| Q |
16 |
aatagaacaatcacaaccactcaacaaaccacctcgtataccaactaagtgtttcaaaacatgattgctcttatcaccattttcgttcttcttactcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725649 |
aatagaacaatcacaaccactcaacaaaccacctcgtataccaactaagtttttcaaaacatgattgctcttatcaccattttcgttcttcttactcatt |
39725748 |
T |
 |
| Q |
116 |
ttgccacctttatcattaaaag |
137 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
39725749 |
ttgccacttttatcattaaaag |
39725770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 207 - 312
Target Start/End: Original strand, 39725837 - 39725942
Alignment:
| Q |
207 |
gaaccttgaggtcttgcaatcctatttctggagtagggacaacacctaaacggaaaatttcccaaaccgatgattttctactttgagatatagatattct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39725837 |
gaaccttgaggtcttgcaatcctatttctggagtagggacaacacctaaacggaaaatttcccaaaccgatgattttctactttgagatatagattttct |
39725936 |
T |
 |
| Q |
307 |
tcgaca |
312 |
Q |
| |
|
| |||| |
|
|
| T |
39725937 |
tggaca |
39725942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University