View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14828_high_6 (Length: 245)
Name: NF14828_high_6
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14828_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 11420578 - 11420797
Alignment:
| Q |
11 |
catcatcatggaatggtgttctttgtaatggtggtaatgttgctggtgttgtccttgataacttaggtctctctgctgattctgatttgagtgttttttc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11420578 |
catcttcatggaatggtgttctttgtaatggtggtaatgttgctggtgttgtccttgataacttaggtctctctgctgattctgatttgagtgttttttc |
11420677 |
T |
 |
| Q |
111 |
aaacctctcaaagcttgtgaaactttccatgtccaacaattccatatcgggaaaattaccaaataacattgccgatttcaaaagccttgaatttcttgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11420678 |
aaacctctcaaagcttgtgaaactttccatgtccaacaattccatatcgggaaaattaccaaataacattgccgatttcaaaagccttgaatttcttgat |
11420777 |
T |
 |
| Q |
211 |
atttccaataacctcttttc |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11420778 |
atttccaataacctcttttc |
11420797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University