View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14828_high_7 (Length: 235)
Name: NF14828_high_7
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14828_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 32702864 - 32703065
Alignment:
| Q |
1 |
tatttgccaccaggccttgtgttgttcacaatgtaaagcagggacagattttcacattaccacttttgtcgaggtaaaatcactattcacattagtcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702864 |
tatttgccaccaggccttgtgttgttcacaatgtaaagcagggacagattttcacattaccacttttgtcgaggtaaaatcactattcacattagtcttt |
32702963 |
T |
 |
| Q |
101 |
ctcatatattaaccttctcatataataactattttttgcttcttccttttaggttaagaaggaaagtcctttcgtgcggcatatagagagtttctagaag |
200 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702964 |
ctcatatattaaccttttcat---ataactattttttgcttcttccttttaggttaagaaggaaagtcctttcgtgcggcatatagagagtttctagaag |
32703060 |
T |
 |
| Q |
201 |
gatga |
205 |
Q |
| |
|
||||| |
|
|
| T |
32703061 |
gatga |
32703065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University