View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14828_high_8 (Length: 223)

Name: NF14828_high_8
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14828_high_8
NF14828_high_8
[»] chr4 (1 HSPs)
chr4 (18-208)||(55478915-55479102)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 55478915 - 55479102
Alignment:
18 ggacaaaggaaaaatggaaatcccaatacccaactttagagtcctgacttattattattcctattattactactcatgtcatgatatgtgcgatctcttt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||||||||||||||||||||||||||||||||||    
55478915 ggacaaaggaaaaatggaaatcccaatacccaactttagagtcctgacttattattctt---attattactactcatgtcatgatatgtgcgatctcttt 55479011  T
118 aataatttcacttgaaattttactcttgagacttgattacatgttcttcaccataaacaactagtgaggctggcaaatagtacaagtttat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55479012 aataatttcacttgaaattttactcttgagacttgattacatgttcttcaccataaacaactagtgaggctggcaaatagtacaagtttat 55479102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University