View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14828_low_10 (Length: 209)
Name: NF14828_low_10
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14828_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 41169022 - 41168827
Alignment:
| Q |
1 |
ctcccttgcccgttttatctgcaaatccaccattcaaatgtgacaaataaatgatatcaaaaatctaaaccaacttcactagacctccaatgttttgctt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41169022 |
ctcccttgccctttttatctgcaaatccaccatacaaatgtgacaa-taaatgatatcaaagatctaaaccaacttcactagacctccaatgttttgctt |
41168924 |
T |
 |
| Q |
101 |
tctcaaaaccattggtataattttcaaaatcatcaatagtttggtcaatctcttcttgagtattcatcacaaagggtccaaattgtaccacaggttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41168923 |
tctcaaaaccattggtataattttcaaaatcatcaatagtttggtcaatctcttcttgagtattcatcacaaagggtccaaattgtaccactggttc |
41168827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University