View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14828_low_5 (Length: 287)
Name: NF14828_low_5
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14828_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 269
Target Start/End: Original strand, 33969415 - 33969671
Alignment:
| Q |
13 |
gagatgaagtgaagagaatgatggaagagattgatactgatggtgacggattcatttcttatgatgagttcactgaattcgcaaaagccaaccgtggtct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969415 |
gagatgaagtgaagagaatgatggaagagattgatactgatggcgacggattcatttcttatgatgagttcactgaattcgcaaaagccaaccgtggtct |
33969514 |
T |
|
| Q |
113 |
agtcaaagatgtcgccaagannnnnnnnnnnnnnnncgcacctttaacctacctttgttggttgatttcattagagttttcaaaaatatattatatgtgt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969515 |
agtcaaagatgtcgccaagattttttaactttttttcgcacctttaacctacctttgttggttgatttcattagagttttcaaaaatatattatatgtgt |
33969614 |
T |
|
| Q |
213 |
gcatgatttctatattacattatgacaatgaaaggttcattaatttcatgaagttat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969615 |
gcatgatttctatattacattatgacaatgaaaggttcattaatttcatgaagttat |
33969671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University