View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14828_low_9 (Length: 223)
Name: NF14828_low_9
Description: NF14828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14828_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 55478915 - 55479102
Alignment:
| Q |
18 |
ggacaaaggaaaaatggaaatcccaatacccaactttagagtcctgacttattattattcctattattactactcatgtcatgatatgtgcgatctcttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55478915 |
ggacaaaggaaaaatggaaatcccaatacccaactttagagtcctgacttattattctt---attattactactcatgtcatgatatgtgcgatctcttt |
55479011 |
T |
 |
| Q |
118 |
aataatttcacttgaaattttactcttgagacttgattacatgttcttcaccataaacaactagtgaggctggcaaatagtacaagtttat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55479012 |
aataatttcacttgaaattttactcttgagacttgattacatgttcttcaccataaacaactagtgaggctggcaaatagtacaagtttat |
55479102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University