View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14829_low_2 (Length: 444)
Name: NF14829_low_2
Description: NF14829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14829_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 120 - 429
Target Start/End: Complemental strand, 1830903 - 1830598
Alignment:
| Q |
120 |
ttgcttgcatgtatcctggttgtttgttatttaagatatattaagtaaaggtaaagatggaaatgttctatacttctgttgtaaggaatagttttttcaa |
219 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1830903 |
ttgcttgcatgtatcctagttgtt----atttaagatatattaagtaaaggtaaagatggaaatgttctatacttctgttgtaaggaatagtttcttcaa |
1830808 |
T |
|
| Q |
220 |
gcacgttgattatatggaccttttagaccaagaaaactgacagtttttccgtagatagaaccttggagcgctctttcatataannnnnnnggtctcccag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||| || |
|
|
| T |
1830807 |
gcacgttgattatatggaccttttagaccaagaaaactgacaggttttccgtagatagaaccctggagcgctctttcatataatttttttggtctccgag |
1830708 |
T |
|
| Q |
320 |
ccaaccattggattactcattcggggacaggtttccggtgcaattgctcaaatcggtgagtttggttttgatcgtagagattgagaagaagagatttgaa |
419 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1830707 |
ccaaccattggattactcatttggggacaggtttccggtgcaattgctcaaatcggtgagtttggttttgatcgtagagattgagaagaagagatttgaa |
1830608 |
T |
|
| Q |
420 |
gacaaagatg |
429 |
Q |
| |
|
| |||||||| |
|
|
| T |
1830607 |
gtcaaagatg |
1830598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 9161236 - 9161165
Alignment:
| Q |
15 |
tgggtatgacagcttgaaagatcatgtgttgattgcctttgatgatggaagatgattgggatgtgacaaaat |
86 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||||||||||||| ||| || |||||| |
|
|
| T |
9161236 |
tgggtatgatagcttgaaagatcaaccattgattgccttagatgatggaagatgattgtgatatgtcaaaat |
9161165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 70 - 113
Target Start/End: Complemental strand, 1831036 - 1830993
Alignment:
| Q |
70 |
ttgggatgtgacaaaatgcattttcatttcattattttataagt |
113 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
1831036 |
ttgggatgttacaaaatgcacttccatttcattattttataagt |
1830993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 9170058 - 9169991
Alignment:
| Q |
19 |
tatgacagcttgaaagatcatgtgttgattgcctttgatgatggaagatgattgggatgtgacaaaat |
86 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||||||| ||| || |||||| |
|
|
| T |
9170058 |
tatgatagcttgaaagatcaatcattgattgccttggatgatggaagatgattgtgatatgtcaaaat |
9169991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 9218145 - 9218088
Alignment:
| Q |
15 |
tgggtatgacagcttgaaagatcatgtgttgattgcctttgatgatggaagatgattg |
72 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
9218145 |
tgggtatgatagcttgaaagatcagccattgattgtcttggatgatggaagatgattg |
9218088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 9155324 - 9155268
Alignment:
| Q |
15 |
tgggtatgacagcttgaaagatcatgtgttgattgcctttgatgatggaagatgatt |
71 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
9155324 |
tgggtatgacagcttgaaagatcaatcattgattatcttggatgatggaagatgatt |
9155268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University