View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14829_low_3 (Length: 431)
Name: NF14829_low_3
Description: NF14829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14829_low_3 |
 |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 4 - 162
Target Start/End: Complemental strand, 10565073 - 10564916
Alignment:
| Q |
4 |
gttgtacaaatatcatttctcttttagctattacttgatggtagtttataggatgcacaaatgattaaatttatttattcatatggaagtgctattttta |
103 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10565073 |
gttgtaaaaatat-atttctcttttagttataacttgatggtagtttataggatgcacaaatgattaaatttatttattcatatggaagtgcaattttta |
10564975 |
T |
 |
| Q |
104 |
ccattgatttaatagttttaaatcaaatgacttggatttattaaggacactctactagt |
162 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10564974 |
ccatttatttaatagttttaaatcaaatgacttggatttataaaggacactctactagt |
10564916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 31326732 - 31326704
Alignment:
| Q |
2 |
tggttgtacaaatatcatttctcttttag |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31326732 |
tggttgtacaaatatcatttctcttttag |
31326704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 4064 - 4036
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4064 |
atggttgtacaaatatcatttctctttta |
4036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 199288 - 199260
Alignment:
| Q |
2 |
tggttgtacaaatatcatttctcttttag |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
199288 |
tggttgtacaaatatcatttctcttttag |
199260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 44380662 - 44380690
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44380662 |
atggttgtacaaatatcatttctctttta |
44380690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 4434505 - 4434477
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4434505 |
atggttgtacaaatatcatttctctttta |
4434477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 30
Target Start/End: Complemental strand, 43358635 - 43358607
Alignment:
| Q |
2 |
tggttgtacaaatatcatttctcttttag |
30 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43358635 |
tggttgtacaaatatcatttctcttttag |
43358607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 49194907 - 49194879
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49194907 |
atggttgtacaaatatcatttctctttta |
49194879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 10749727 - 10749755
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10749727 |
atggttgtacaaatatcatttctctttta |
10749755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 42256483 - 42256455
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42256483 |
atggttgtacaaatatcatttctctttta |
42256455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 48325815 - 48325843
Alignment:
| Q |
1 |
atggttgtacaaatatcatttctctttta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48325815 |
atggttgtacaaatatcatttctctttta |
48325843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University