View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1482_high_13 (Length: 322)
Name: NF1482_high_13
Description: NF1482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1482_high_13 |
 | |
|
| [»] scaffold0743 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 303
Target Start/End: Complemental strand, 17945119 - 17944829
Alignment:
| Q |
13 |
attctttcagtttcctttcattcgtgaaagctatagtgtcttaatttgatggagtcatcatttccttaggaattataatattcactgaattaaatatcaa |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17945119 |
attcttttagtttcctttcattcgtgaaagctatagtgtcttaatttgatggagtcatcatttccttaggaattatagtattcactgaattaaatatcaa |
17945020 |
T |
|
| Q |
113 |
atttatcttcaatgttttgtaggcacctcattttcagtaattgtcttcaagtttttgattcatatctgcaaattgcacttcttgctctttgcctctaaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17945019 |
atttatcttcaatgttttgtaggcacctcattttcagtaattgtcttcaagtttttgattcatatttgcaaattgcacttcttgctctttgcctctaaat |
17944920 |
T |
|
| Q |
213 |
ccccttatgcatgcaaacttcagctttagatcaatactgtctcacaattctatcctctcgaatggcaaagcacagttatcattatagctac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17944919 |
ccccttatgcatgcaaacttcagctttagatcaatactgtctcacaattctatcctctcgaatggtaaagcacagttatcattatagctac |
17944829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0743 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 179 - 303
Target Start/End: Original strand, 4085 - 4209
Alignment:
| Q |
179 |
tgcaaattgcacttcttgctctttgcctctaaatccccttatgcatgcaaacttcagctttagatcaatactgtctcacaattctatcctctcgaatggc |
278 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
4085 |
tgcaaattgcacttctttctctttgcctctaaatccccttatacatacaaacttcagcttttgatcaatagtgtcacacaattctaacctctcgaatggt |
4184 |
T |
|
| Q |
279 |
aaagcacagttatcattatagctac |
303 |
Q |
| |
|
||| |||| ||||||||| |||||| |
|
|
| T |
4185 |
aaaacacaattatcattagagctac |
4209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University